Supplemental Information MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos

نویسندگان

  • Nayoung Suh
  • Lauren Baehner
  • Felix Moltzahn
  • Collin Melton
  • Archana Shenoy
  • Jing Chen
  • Robert Blelloch
چکیده

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To determine brood size, Dgcr8 ;Zp3-Cre or control females were bred with several wild type males. The control mice we used are littermates with the genotype of Dgcr8;Zp3-Cre, Dgcr8, Dgcr8 . Fully grown GV-intact cumulusenclosed oocytes were obtained as previously described [2] from PMSG-primed, 4 to 6-week-old females in MEM medium with 5 uM Cilostamide to prevent resumption of meiosis during isolation. For spontaneous maturation, oocytes were allowed to mature in Cilostamide-free medium in an atmosphere of 5% CO2 in air at 37 °C for 8 h (MI oocyte) or 16 h (MII oocyte). Meiosis II oocytes were collected 14-16 hour post hCG injection from females previously primed with PMSG. Zygotes were obtained from the primed females mated to males after 18-20 hours post hCG stimulation. Embryos were then cultured in EmbryoMax KSOM medium (Millipore) in an atmosphere of 5% CO2 in air at 37 °C until blastocysts stages.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

MicroRNA Function Is Globally Suppressed in Mouse Oocytes and Early Embryos

Dicer, which is required for the processing of both microRNAs (miRNAs) and small interfering RNAs (siRNAs), is essential for oocyte maturation [1, 2]. Oocytes express both miRNAs and endogenous siRNAs (endo-siRNAs) [3, 4]. To determine whether the abnormalities in Dicer knockout oocytes during meiotic maturation are secondary to the loss of endo-siRNAs and/or miRNAs, we deleted Dgcr8, which enc...

متن کامل

Highly sensitive sequencing reveals dynamic modifications and activities of small RNAs in mouse oocytes and early embryos

Small RNAs play important roles in early embryonic development. However, their expression dynamics and modifications are poorly understood because of the scarcity of RNA that is obtainable for sequencing analysis. Using an improved deep sequencing method that requires as little as 10 ng of total RNA or 50 oocytes, we profile small RNAs in mouse oocytes and early embryos. We find that microRNA (...

متن کامل

MicroRNA-27a activity is not suppressed in porcine oocytes.

MicroRNAs (miRNAs) are a class of small noncoding RNAs involved in multiple cellular processes. Recent findings indicate that miRNA activity is globally suppressed in mouse oocytes. However, whether miRNAs are expressed and function in porcine oocytes remains unknown. In this study, our aims were to ascertain if miRNA biogenesis occurs and whether miRNA activity is globally suppressed during po...

متن کامل

P-89: The Developmental Rates of Early Mouse Embryos Derived from In Vitro Fertilization of Mature Oocytes Obtained from Ovarian Stimulation Using A Combination of HMG and Estradiol Valerate

Background: In recent years, a combination of hormones and agents in assisted reproductive technology (ART) cycles as a means of stimulating the ovary and developing more follicles. With respect to the positive effects of Estradiol Valerate on reproductive tissues and the impact on native genes of the egg that transferred to the embryo after fertilization, it seems that this agent can also effe...

متن کامل

P-229: Chromosomal Analysis of Parthenogenetic Mouse Embryos Generated from In Vitro Activated Oocytes by Hydrostatic Pressure and Ethanol and Cytochalasin B

Background: Studies of preimplantation stage embryos by classic cytogenetic techniques have limitations, starting with the need for good metaphase stage when only one third of all analyzed embryos may show good quality metaphases. The incidence of chromosome anomalies in embryos produced by in vitro procedures is generally higher than that of embryos formed in vivo. Pressure specifically affect...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2010